b2670

Information for b2670, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2796112-2796516 - CDS stpA EG11554 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing? 2797185-2797634 + CDS b2670 EG13525 orf; hypothetical protein 2797671-2798015 - CDS ygaC EG12201 orf; hypothetical protein

Reported regulatory sites for b2670: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.837 2796958-2796979 atcta ATTGATTTAATTAAAAATAAAT catat - 0 - 2.837 2797058-2797079 taaat AAAAATTTTTCACTAATTGATT agtca - 0 - 2.574 2797032-2797047 ggaat ATTTTATCTACAAAAA ctgac - 0 - 0.971 2796798-2796820 aaaag AAAACATCCATCACTGGTGCTTT ctgct - 0 - 0.971 2797013-2797035 acaaa AAACGAGCCGTTACGGAATATTT tatct - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back