b2809

Information for b2809, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2939672-2940589 - CDS gcvA EG11795 positive regulator of gcv operon 2940940-2941170 - CDS b2809 EG13081 orf; hypothetical protein 2941359-2942564 + CDS b2810 EG13082 orf; hypothetical protein

Reported regulatory sites for b2809: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.836 2941229-2941245 R catat GCTGAATAGTGTTAGGC gttaa - 0 - 2.789 2941290-2941307 R gatac AAGGAGAGTGCTAACCAT cagaa - 0 - 2.744 2941265-2941284 R cagaa TTATCTGGATATCCTGGCGA agccg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back