b2810

Information for b2810, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2940940-2941170 - CDS b2809 EG13081 orf; hypothetical protein 2941359-2942564 + CDS b2810 EG13082 orf; hypothetical protein 2942564-2943007 + CDS ygdK EG13083 orf; hypothetical protein

Reported regulatory sites for b2810: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.885 2941226-2941248 aaatt AACGCCTAACACTATTCAGCATA tgtta - 0 - 1.713 2941172-2941187 tcatc TTCTCCTTAAAGCGAT taata - 0 - 1.555 2941200-2941221 tctta ATAGTATTGATTAACAGGCTAA aatta - 0 - 1.555 2941264-2941285 gcggc TTCGCCAGGATATCCAGATAAT tctga - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back