b2817

Information for b2817, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2945629-2945705 + tRNA metV EG30060 Initiator methionine tRNAf1; triplicate gene 2945779-2947122 - CDS b2817 EG13086 putative amidase 2947264-2948595 + CDS argA EG10063 N-acetylglutamate synthase; amino acid acetyltransferase

Reported regulatory sites for b2817: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.667 2947182-2947198 R gtgca AGTGTAAATTTTATGCG agagc - 0 - 4.164 2947220-2947242 R tgatt ATTCGAAATTAGTGTATTTTTAT tctgt argR 20 - 4.164 2947129-2947151 R cgtga ATATAAAAAGAATGTTTACCGTT tatta - 0 - 0.169 2947154-2947175 R gagcg ACTTTTTTATCAGTAATGCCGT gaata - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back