b2832

Information for b2832, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2967684-2968373 + CDS mutH EG10624 methyl-directed mismatch repair 2968442-2969155 + CDS b2832 EG13092 putative transport protein 2969293-2969511 + CDS b2833 EG13076 orf; hypothetical protein

Reported regulatory sites for b2832: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.870 2968403-2968425 cgggc ATATAATTACCGCTTCATTTTTT tggca - 0 - 1.658 2968371-2968388 tccag TAGCCATCGCTTTGACCT gccgc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back