b2833

Information for b2833, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2968442-2969155 + CDS b2832 EG13092 putative transport protein 2969293-2969511 + CDS b2833 EG13076 orf; hypothetical protein 2969619-2970659 + CDS b2834 EG13093 orf; hypothetical protein

Reported regulatory sites for b2833: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.887 2969249-2969265 ggttt ATAAACAGACTATTATC atagg - 0 - 2.668 2969205-2969224 ccctc ACAGTTTAAGATTTTCCTGC tttca - 0 - 2.653 2969166-2969183 cgtac GCTCTCCTGCGGGAGGGC gtact - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back