b2834

Information for b2834, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2969293-2969511 + CDS b2833 EG13076 orf; hypothetical protein 2969619-2970659 + CDS b2834 EG13093 orf; hypothetical protein 2970691-2971884 - CDS ygeD EG12455 putative resistance proteins

Reported regulatory sites for b2834: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.297 2969592-2969615 cctta TGTCGTGATTATAAAAAGGAAACG gctat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back