b2970

Information for b2970, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3109145-3110005 - CDS yghE EG12989 putative general secretion pathway for protein export (GSP) 3110071-3110937 - CDS b2970 EG12990 putative general secretion pathway for protein export (GSP) 3111084-3111494 - CDS b2971 EG12991 orf; hypothetical protein

Reported regulatory sites for b2970: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.926 3111025-3111045 R ttcgt GACGCACGAATTTATCTCATT caatg - 0 - 0.849 3110967-3110984 R gagac AATCTCTTAATACAGACA aagag - 0 -

Critical MAP values: p=0.01 3.18 p=0.05 2.36 p=0.1 2.00 p=0.2 1.60

Click here to go back