b2989

Information for b2989, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3134678-3136537 - CDS gsp EG12882 glutathionylspermidine synthetase/amidase 3136694-3137608 + CDS b2989 EG13005 orf; hypothetical protein 3137731-3137979 - CDS hybG EG11805 hydrogenase-2 operon protein: may effect maturation of large subunit of hydrogenase-2

Reported regulatory sites for b2989: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.789 3136620-3136643 ggaca GAGGTCAGACTAATCATACACCTC atcgc - 0 - 2.177 3136597-3136619 ttacc TGCTCAGCGACATTAACCGGACA gaggt - 0 - 1.437 3136586-3136605 ttgtg CTCTGATTACCTGCTCAGCG acatt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back