b3052

Information for b3052, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3190880-3192541 + CDS b3051 EG14232 putative membrane protein 3192961-3194394 - CDS b3052 EG13416 putative kinase 3194442-3197282 - CDS glnE EG11602 adenylylating enzyme for glutamine synthetase

Reported regulatory sites for b3052: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.654 3194415-3194434 R tatgg TATTATCGCGCGCAAATTTT gaatc - 0 - 1.974 3194397-3194414 R atttt GAATCTCTCAGGAGACAG gaatg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back