b4256

Information for b4256, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4476036-4476452 + CDS yjgD EG12453 orf; hypothetical protein 4476597-4476890 - CDS b4256 EG12532 orf; hypothetical protein 4477310-4478491 + CDS yjgN EG12533 orf; hypothetical protein

Reported regulatory sites for b4256: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.102 4476969-4476989 R ccgct GATAAAGGCTACACCGTCGCC gatcc - 0 - 3.657 4476945-4476967 R cgccg ATCCGAATCTTGACGAGCTGTAT caagt - 0 - 3.252 4477004-4477025 R gcgtc ATTCGTCAGGTATCCGCCGAAT acggt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back