barA

Information for barA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2911721-2913022 - CDS ygcA EG11247 putative enzyme 2913079-2915835 + CDS barA EG11367 sensor-regulator; activates OmpR by phophorylation 2916067-2917407 - CDS ygcX EG13167 putative glucarate dehydratase

Reported regulatory sites for barA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.824 2913034-2913052 gactt TCTCAATTTAACAGTGTGA cctta - 0 - 4.638 2913053-2913072 tgtga CCTTAATTGTCCCATAACGG aactc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back