betI

Information for betI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 326485-327957 - CDS betB EG10110 NAD+-dependent betaine aldehyde dehydrogenase 327971-328558 - CDS betI EG10111 probably transcriptional repressor of bet genes 328687-330720 + CDS betT EG10112 high-affinity choline transport

Reported regulatory sites for betI: Genome coordinates Source Transcription factor Transcription factor annotation 328605-328625 PMID: 8626295 betI probably transcriptional repressor of bet genes

Species with an ortholog: PA EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.699 328605-328624 R cattt TATATTGAACGTCCAATCAA taacc betI 20 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.694 328620-328640 R cgtaa CAATTAAGACACATTTTATAT tgaac betI 6 - 1.033 328654-328673 R cccac TGTTATTGTTACTATTTAAA atcaa - 0 - 1.033 328633-328652 R taaaa TCAAATTCGTAACAATTAAG acaca - 0 -

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back