bioA

Information for bioA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 806656-807132 - CDS ybhB EG11238 orf; hypothetical protein 807191-808480 - CDS bioA EG10117 7;8-diaminopelargonic acid synthetase 808567-809607 + CDS bioB EG10118 biotin synthesis; sulfur insertion?

Reported regulatory sites for bioA: Genome coordinates Source Transcription factor Transcription factor annotation 808487-808521 PMID: 8113219 birA biotin-[acetylCoA carboxylase] holoenzyme synthetase and biotin operon repressor

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.027 808508-808527 R tcggt GTAGACTTGTAAACCTAAAT ctttt birA 14 - 3.027 808482-808501 R ttttc AATTTGGTTTACAAGTCGAT tatga birA 15 - 2.323 808537-808560 R gggct TCTCCAAAACGTGTTTTTTGTTGT taatt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back