bolA

Information for bolA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 452813-453493 - CDS yajG EG12182 putative polymerase/proteinase 453663-454013 + CDS bolA EG10125 possible regulator of murein genes 454357-455655 + CDS tig EG11003 trigger factor; a molecular chaperone involved in cell division

Reported regulatory sites for bolA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.474 453597-453615 ggacg AAACCTAAATATTTGTTGT taagc - 0 - 2.254 453550-453569 tttca ATCTTTAAATCAGTAAACTT catac - 0 - 1.332 453628-453651 caatg GAAACGGTAAAAGCGGCTAGTATT taaag - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back