brnQ

Information for brnQ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 417113-418408 + CDS phoR EG10733 positive and negative sensor protein for pho regulon 418815-420134 + CDS brnQ EG12168 branched chain amino acid transport system II carrier protein 420210-421583 + CDS proY EG13609 proline permease transport protein

Reported regulatory sites for brnQ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.133 418612-418635 cttgc TTTAAAACGTTATAAGCGTTTAAA ttgcg - 0 - 3.133 418715-418738 gggag TATTTCCCGCTAAAATTGTTTAAA tatac - 0 - 1.180 418500-418521 acgat TGGTGATTTTTTGTTCGCATGA ttagc - 0 - 0.952 418681-418700 taaat CGAAAAACTATTCTTCGCCG cgcct - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back