cadA

Information for cadA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4352532-4353989 - CDS yjdL EG12469 putative peptide transporter 4354048-4356195 - CDS cadA EG10131 lysine decarboxylase 1 4356275-4357609 - CDS cadB EG10132 transport of lysine/cadaverine

Reported regulatory sites for cadA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.396 4356210-4356232 R cccat GTGTTGGGAGGGGCCTTTTTTAC ctgga - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back