caiB

Information for caiB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 36271-37839 - CDS caiC EG11558 probable crotonobetaine/carnitine-CoA ligase 37898-39115 - CDS caiB EG11559 l-carnitine dehydratase 39244-40386 - CDS caiA EG11560 probable carnitine operon oxidoreductase

Reported regulatory sites for caiB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.970 39199-39214 R ctgat GCGTCTTATCAGGCCT acggg - 0 REP4b (16) 2.970 39167-39182 R aatgt AGGCCGGATAAAGCGT ttacg - 0 REP4a (16) 2.140 39137-39158 R cgccg CATCCGGCAGTCATGCGCTACA taaat - 0 REP4a (8) 0.328 39223-39240 R aagtc CGTGCGCTGCCTGATGCG acgct - 0 REP4b (10)

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back