caiF

Information for caiF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 30817-34038 + CDS carB EG10135 carbamoyl-phosphate synthase large subunit 34195-34695 + CDS caiF EG13451 transcriptional regulator of cai operon 34781-35392 - CDS caiE EG12608 possible synthesis of cofactor for carnitine racemase and dehydratase

Reported regulatory sites for caiF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.677 34165-34188 tgaca TAAGCAGGATTTAGCTCACACTTA tcgac - 0 - 1.072 34091-34112 ctaat ACGGTTCTCTGATGAGGACCGT ttttt - 0 - - 0.128 34070-34085 tccgc TAATTTGATCGAATAA ctaat - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back