caiT

Information for caiT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 39244-40386 - CDS caiA EG11560 probable carnitine operon oxidoreductase 40417-41931 - CDS caiT EG11561 probable carnitine transporter 42367-43173 + CDS fixA EG11562 probable flavoprotein subunit; carnitine metabolism

Reported regulatory sites for caiT: Genome coordinates Source Transcription factor Transcription factor annotation 42068-42089 PMID: 9573142 crp cyclic AMP receptor protein

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.028 42318-42335 R cgccc TTTAATTTTGAAATAAAA cttta - 0 - 4.691 42296-42311 R tttaa TCACCAATATTGAAAA tgtca - 0 - 4.691 42237-42252 R gttcc TCACCAATATTGAAAA cacgg caiF crp 16 8 - 3.673 42340-42359 R cggtg GTGTTAATTACAGATATCAC gccct - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back