carA

Information for carA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 28374-29195 + CDS dapB EG10206 dihydrodipicolinate reductase 29651-30799 + CDS carA EG10134 carbamoyl-phosphate synthetase; glutamine (small) subunit 30817-34038 + CDS carB EG10135 carbamoyl-phosphate synthase large subunit

Reported regulatory sites for carA: Genome coordinates Source Transcription factor Transcription factor annotation 29602-29619 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 29623-29640 DPInteract argR repressor of arg regulon; cer-mediated site specific recombination 29364-29388 DPInteract carP aminopeptidase A/I 29462-29486 DPInteract carP aminopeptidase A/I 29410-29435 DPInteract purR transcriptional repressor for pur regulon glyA glnB prsA speA 29240-29252 RegulonDB ihf integration host factor (IHF)

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.641 29604-29627 cattg TGAATTAATATGCAAATAAAGTGA gtgaa argR 21 - 3.366 29571-29586 gtcgg TAAGCAGATTTGCATT gattt - 0 - 2.898 29626-29641 aaagt GAGTGAATATTCTCTG gaggg argR 15 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back