cbl

Information for cbl, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2057873-2057948 + tRNA asnU EG30021 Asparagine tRNA 2057986-2058936 - CDS cbl EG14264 transcriptional regulator cys regulon; accessory regulatory circuit affecting cysM 2059038-2059955 - CDS nac EG14265 nitrogen assimilation control protein

Reported regulatory sites for cbl: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.301 2058999-2059020 R gatgg AATAAGATGCGGGTTTTTATTA tttgt - 0 - 1.284 2059014-2059036 R ctaag TGTTATATCGGGATGGAATAAGA tgcgg - 0 - 0.394 2058941-2058961 R acggg AAATCTGAACTGCCCGGAGTT taccg - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back