cbpA

Information for cbpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1061773-1062078 - CDS yccD EG12194 orf; hypothetical protein 1062078-1062998 - CDS cbpA EG12193 curved DNA-binding protein; functions closely related to DnaJ 1063259-1064515 + CDS yccE EG12196 orf; hypothetical protein

Reported regulatory sites for cbpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.121 1063057-1063080 R tatga AATTTTGAGGATTACCCTACACTT atagg - 0 - 3.121 1063024-1063047 R gagtt ACCTTACAGGGGTTCCTTCAATTT gtgtt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back