cca

Information for cca, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3198848-3199468 + CDS ygiM EG12434 orf; hypothetical protein 3199532-3200770 + CDS cca EG10136 tRNA nucleotidyl transferase 3200951-3201772 - CDS bacA EG11665 bacitracin resistance; possibly phosphorylates undecaprenol

Reported regulatory sites for cca: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.761 3199488-3199505 tgcac TGTCTTATTATTAGGAAT tgtgt - 0 - 0.070 3199466-3199486 tgaac TAAATCGCCTTCTTCGTTGCA ctgtc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back