cchB

Information for cchB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2568368-2569771 - CDS eutE EG14185 ethanolamine utilization; similar to acetaldehyde dehydrogenase 2569783-2570070 - CDS cchB EG14186 detox protein 2570177-2570512 - CDS cchA EG14187 detox protein

Reported regulatory sites for cchB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.972 2570146-2570167 R cctgt GTGACGTCGATTCGGGCGTCAC gctct - 0 - - 0.641 2570109-2570126 R cattt TACCTTCTGCGGAGGGTA ggggg - 0 - - 0.120 2570071-2570089 R ctgaa ATACGCCACGGAGGCGGGT atgaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back