cdd

Information for cdd, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2229039-2229734 + CDS yohK EG12024 putative seritonin transporter 2229864-2230748 + CDS cdd EG10137 cytidine/deoxycytidine deaminase 2230898-2231617 + CDS sanA EG12025 vancomycin sensitivity

Reported regulatory sites for cdd: Genome coordinates Source Transcription factor Transcription factor annotation 2229736-2229757 DPInteract crp cyclic AMP receptor protein 2229786-2229807 DPInteract crp cyclic AMP receptor protein 2229763-2229787 DPInteract & PMID: 1327747 cytR regulator for deo operon udp cdd tsx nupC and nupG

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.334 2229735-2229758 gctaa AATTTGCGATGCGTCGCGCATTTT tgatg crp 22 - 4.334 2229785-2229808 cataa TTAATGAGATTCAGATCACATATA aagcc cytR crp 3 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.602 2229839-2229861 tatcc CATTACATGATTATGAGGCAACG ccatg - 0 - 2.080 2229768-2229784 gtatg TTTCACGCGTTGCATAA ttaat cytR 17 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back