cdh

Information for cdh, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4106414-4107403 + CDS sbp EG10929 periplasmic sulfate-binding protein 4107510-4108265 + CDS cdh EG10138 CDP-diacylglycerol phosphotidylhydrolase 4108320-4109087 - CDS tpiA EG11015 triosephosphate isomerase

Reported regulatory sites for cdh: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.282 4107456-4107475 tttta TTTGTCACGATTTTGCGTTA ccctt - 0 - 1.195 4107478-4107500 ttacc CTTGCATCTCTTTGAGGTACAGG gaaaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back