cdsA

Information for cdsA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 194903-195664 + CDS yaeS EG13329 orf; hypothetical protein 195785-196534 + CDS cdsA EG10139 CDP-diglyceride synthetase 196546-197898 + CDS yaeL EG12436 orf; hypothetical protein

Reported regulatory sites for cdsA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.624 195679-195702 ctttt GCTGAAGTATCGCCTGATATCTGC ttttg - 0 - 2.624 195709-195732 tttgt GTTAATACCCGTCGTCATCGCGGC gttgt - 0 - 1.137 195758-195774 tgggg TTCGCCATTGTAACGCT ggtgg - 0 - 0.106 195742-195760 tttct GTTGCCGCCGGTGGGGTTC gccat - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back