cdsA
 
Information for cdsA, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
194903-195664
+
CDS
orf; hypothetical protein
195785-196534
+
CDS
cdsA
CDP-diglyceride synthetase
196546-197898
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for cdsA:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.624
195679-195702
ctttt GCTGAAGTATCGCCTGATATCTGC ttttg
-
0
-
2.624
195709-195732
tttgt GTTAATACCCGTCGTCATCGCGGC gttgt
-
0
-
1.137
195758-195774
tgggg TTCGCCATTGTAACGCT ggtgg
-
0
-
0.106
195742-195760
tttct GTTGCCGCCGGTGGGGTTC gccat
-
0
-
 
Critical MAP values:
p=0.01
4.80
p=0.05
3.45
p=0.1
2.95
p=0.2
2.42

Click here to go back