celA

Information for celA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1817880-1819238 - CDS celB EG10141 PEP-dependent phosphotransferase enzyme II for cellobiose; arbutin; and salicin 1819323-1819643 - CDS celA EG10140 PEP-dependent phosphotransferase enzyme IV for cellobiose; arbutin; and salicin 1819942-1820280 - CDS osmE EG10044 activator of ntrL gene

Reported regulatory sites for celA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.833 1819888-1819911 R caacg GAAACCGGCCATTGCGCCGGTTTT ttttg - 0 - 4.833 1819644-1819667 R gacag ATAATCGTCGATGAGGGCAGTTTT atgga - 0 - 3.056 1819850-1819871 R gttct TAATTATCTTCGCGAATTATTT gcccg - 0 - 3.056 1819784-1819805 R gaaac AATTTATAAGGTCAAAGAAATA ctatt - 0 - 2.440 1819691-1819714 R gttac CCAGAGCATGGAAGCAGGTTAAGG cttgc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back