celC

Information for celC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1816629-1817471 - CDS celD EG10143 negative transcriptional regulator of cel operon 1817479-1817829 - CDS celC EG10142 PEP-dependent phosphotransferase enzyme III for cellobiose; arbutin; and salicin 1817880-1819238 - CDS celB EG10141 PEP-dependent phosphotransferase enzyme II for cellobiose; arbutin; and salicin

Reported regulatory sites for celC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.470 1817852-1817873 R cgatg CCGGTACGGGTAATCGTGCCGG taaga - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back