cfa

Information for cfa, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1737935-1739146 + CDS ydhC EG12141 putative transport protein 1739437-1740585 + CDS cfa EG11531 cyclopropane fatty acyl phospholipid synthase 1740625-1741266 - CDS ribE EG11406 riboflavin synthase; alpha chain

Reported regulatory sites for cfa: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.573 1739382-1739401 agccc AAAAAGCGTCTACGCTGTTT taagg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.576 1739364-1739380 ctgcg AGATTTCTCACAAAGCC caaaa - 0 - 4.221 1739411-1739428 gttct GATCACCGACCAGTGATG gagaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back