chaA

Information for chaA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1267388-1268242 + CDS kdsA EG10518 2-dehydro-3-deoxyphosphooctulonate aldolase 1269972-1271072 - CDS chaA EG11753 sodium-calcium/proton antiporter 1271342-1271572 + CDS chaB EG12402 cation transport regulator

Reported regulatory sites for chaA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.222 1271154-1271172 R ggggt AAAAATTCGTAAAATGTTA ccgat - 0 - 2.222 1271125-1271143 R atcca GACACTTTCTGTTATTTTT cctac - 0 - 1.544 1271291-1271314 R gaaca TTAAGTGTGGTCAACAATATCTAC tcttg - 0 - 1.422 1271186-1271207 R tattt TTATGCCCCAATGAGTAAAAAA tcgac - 0 - 1.422 1271095-1271116 R accta TTTTTTACATTTTCGATAAATT catct - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back