chaB

Information for chaB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1269972-1271072 - CDS chaA EG11753 sodium-calcium/proton antiporter 1271342-1271572 + CDS chaB EG12402 cation transport regulator 1271709-1272425 + CDS chaC EG12403 cation transport regulator

Reported regulatory sites for chaB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.050 1271293-1271315 agagt AGATATTGTTGACCACACTTAAT gttca - 0 - 1.991 1271234-1271256 aatgt TTGTTTTAGCGTCTCTTAAGAAG agtct - 0 - 1.358 1271093-1271112 gcaga TGAATTTATCGAAAATGTAA aaaat - 0 - 1.358 1271154-1271173 atcgg TAACATTTTACGAATTTTTA ccccg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back