cirA

Information for cirA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2241930-2242766 + CDS yeiG EG12026 putative esterase (EC 3.1.1.-). 2242798-2244789 - CDS cirA EG10155 outer membrane receptor for iron-regulated colicin I receptor; porin; requires tonB gene product 2245083-2246552 - CDS lysP EG11337 lysine-specific permease

Reported regulatory sites for cirA: Genome coordinates Source Transcription factor Transcription factor annotation 2244967-2244984 DPInteract fur negative regulator

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.613 2245043-2245060 R ctaag CCCTCTCAACCGAGAGGG ctttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.244 2244968-2244988 R atttg GATTGATAATTGTTATCGTTT gcatt fur 17 - 2.110 2244812-2244834 R tgtga GCGATAACCCATTTTATTTTCGT agtta - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back