clpB

Information for clpB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2727636-2729178 - rRNA rrsG EG30089 16S RNA of rrnG operon 2729620-2732193 - CDS clpB EG10157 heat shock protein 2732323-2733054 - CDS yfiH EG12097 orf; hypothetical protein

Reported regulatory sites for clpB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.873 2732230-2732252 R gaata ATTGAGGGATGACCTCATTTAAT ctcca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.537 2732298-2732320 R taacc TAAAGAATCAAGACGATCCGGTA cgcgt - 0 - 2.537 2732206-2732228 R taatc TCCAGTAGCAACTTTGATCCGTT atggg - 0 - 1.046 2732253-2732276 R cacat TAATCTGGTCAATAACCTTGAATA attga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back