clpP

Information for clpP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 454357-455655 + CDS tig EG11003 trigger factor; a molecular chaperone involved in cell division 455901-456524 + CDS clpP EG10158 ATP-dependent proteolytic subunit of clpA-clpP serine protease; heat shock protein F21.5 456650-457924 + CDS clpX EG10159 ATP-dependent specificity component of clpP serine protease; chaperone

Reported regulatory sites for clpP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.072 455742-455763 tggaa CCGTGCGAAAAGCCTCTTTCGG tgtta - 0 - 2.398 455667-455687 cagca TAACGCGCTAAATTCGCACAA aggcc - 0 - 2.398 455721-455741 ttttt TGTCATGAATTTTGCATGGAA ccgtg - 0 - 2.179 455825-455845 aacac AGGGACTAGCTGATAATCCGT ccata - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back