clpX

Information for clpX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 455901-456524 + CDS clpP EG10158 ATP-dependent proteolytic subunit of clpA-clpP serine protease; heat shock protein F21.5 456650-457924 + CDS clpX EG10159 ATP-dependent specificity component of clpP serine protease; chaperone 458112-460466 + CDS lon EG10542 DNA-binding; ATP-dependent protease La; heat shock K-protein

Reported regulatory sites for clpX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.802 456550-456573 cgcta TACTTATCCAGGGCGGCACAACGC tgtaa - 0 - 2.802 456605-456628 cattt GCGTCGTCGTGTGCGGCACAAAGA acaaa - 0 - 2.495 456525-456546 attga TGCCAGAGGCGCAACTGTGCCG ctata - 0 - 2.495 456580-456601 gtaag CGGCTTGCGCCTGAGAATGGCA tttgc - 0 - 1.446 456629-456645 aaaga ACAAAGAAGAGGTTTTG accca - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back