cls

Information for cls, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1304845-1305252 - CDS b1248 EG14256 orf; hypothetical protein 1305209-1306669 - CDS cls EG11608 cardiolipin synthase; a major membrane phospholipid; novobiocin sensitivity 1307040-1308293 - CDS kch EG11606 putative potassium channel protein

Reported regulatory sites for cls: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.506 1306717-1306739 R cccgc GTTTTTATTTGCCAGATGAATCC atatg - 0 - 1.669 1306864-1306884 R ctcaa GCCAACGCGATTTACGTCGGC tagcc - 0 - 1.669 1306840-1306860 R gctag CCTGACGCTGCATGCGCCAGC gcccc - 0 - 1.421 1306770-1306786 R acaga ATGGTCATTATACCCCC acccc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back