cmk

Information for cmk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 959463-960251 + CDS ycaL EG13133 putative heat shock protein 960424-961107 + CDS cmk EG11265 cytidylate kinase 961218-962891 + CDS rpsA EG10900 30S ribosomal subunit protein S1

Reported regulatory sites for cmk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.839 960318-960338 atctg AATACAGACAAAACTGGTTTT tgcac - 0 - 1.750 960286-960302 gccag CCCGCTATAATTGCGCA ataaa - 0 - 1.750 960368-960384 gcgtc GGCGCGTATAATGCGCG cggtt - 0 - 1.255 960249-960268 gtaag TAAATCATTGTCATCTTTCG ggctg - 0 - 1.255 960393-960412 ttatg TTAACGGTACGCCTGTTTTA aggag - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back