cmr

Information for cmr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 882015-882611 - CDS ybjG EG13676 orf; hypothetical protein 882896-884128 + CDS cmr EG13696 proton motive force efflux pump 884169-884453 - CDS ybjH EG13677 orf; hypothetical protein

Reported regulatory sites for cmr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.538 882866-882888 aaact CTGCGCGATTATTATTGGCGAAG aaatt - 0 - 2.231 882806-882824 aatgt GCTTAACCGTGGTTTCAGC tacaa - 0 - 1.939 882750-882766 gggca TAGGTTAAATAAAACTT aaaga - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back