cobU

Information for cobU, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2062501-2063244 - CDS cobS EG12150 cobalamin 5'-phosphate synthase 2063241-2063786 - CDS cobU EG13238 cobinamide kinase/cobinamide phosphate guanylyltransferase 2064327-2065343 - CDS trs5_6 - IS5 transposase

Reported regulatory sites for cobU: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.570 2063794-2063813 R aatac CATCATACATTTGAATCAGG agtcg - 0 - 1.029 2063876-2063893 R ttaat TATATTACGCGCAGTATT aatcg - 0 - 0.617 2063836-2063851 R ggtca GCAACGGTGGGGGATC cattg - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back