codB

Information for codB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 351930-353816 + CDS prpE EG13604 putative propionyl-CoA synthetase 354146-355405 + CDS codB EG11327 cytosine permease/transport 355395-356678 + CDS codA EG11326 cytosine deaminase

Reported regulatory sites for codB: Genome coordinates Source Transcription factor Transcription factor annotation 354059-354084 DPInteract purR transcriptional repressor for pur regulon glyA glnB prsA speA

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.973 354095-354115 gatga ATAGAATGCGGCGGATTTTTT gggtt - 0 - 4.513 354064-354079 tcccc ACGAAAACGATTGCTT tttat purR 16 - 3.877 353869-353885 gcctg ATGCGACGCTGACGCGT tttat - 0 REP26b (17) 3.877 353963-353979 gcctg ATGCGACGCTGACGCGT cttat - 0 REP26d (17)

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back