corA

Information for corA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3998183-3998668 - CDS yigE EG11462 orf; hypothetical protein 3999038-3999988 + CDS corA EG11463 Mg2+ transport; system I 4000031-4000411 - CDS yigF EG11464 orf; hypothetical protein

Reported regulatory sites for corA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.186 3998877-3998893 aggat CAACTCCTAAGGCTATC ccttt - 0 - 3.186 3998904-3998920 ttgct GATAGCCTTAGCGGTTG tcagc - 0 - 3.077 3998697-3998719 tttta TCCTGTTAGCGACCTTGACGAGT accaa - 0 - 3.077 3998825-3998847 gacat TCGCCTTGGACACACCCAGTAGA tactg - 0 - 2.852 3998723-3998738 gtacc AAAAAGCGCGAAGTTC aacta - 0 - 2.852 3998793-3998808 ggcgt AACATGCGCGCACGAT cactc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back