cpdB

Information for cpdB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4431601-4432071 + CDS ytfH EG12508 orf; hypothetical protein 4432200-4434143 - CDS cpdB EG10160 2':3'-cyclic-nucleotide 2'-phosphodiesterase 4434333-4435073 + CDS cysQ EG10043 affects pool of 3'-phosphoadenosine-5'-phosphosulfate in pathway of sulfite synthesis

Reported regulatory sites for cpdB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.483 4434272-4434292 R ttgtt TTACTTATACCCTATCGTTAA tgaat - 0 - 2.483 4434156-4434176 R ttttc TTTCGTATTCCCGATGATAAA aggat - 0 - 1.713 4434237-4434258 R ccaac TGTGATAGTGTCATCATTTTCA aagcg - 0 - 0.825 4434201-4434223 R aattg TGGCATTCTTCACTGTTCTATAA gtaag - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back