cpsG

Information for cpsG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2118182-2119576 - CDS wcaJ EG13575 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase 2119631-2121001 - CDS cpsG EG10162 phosphomannomutase 2121106-2122542 - CDS cpsB EG10161 mannose-1-phosphate guanyltransferase

Reported regulatory sites for cpsG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.536 2121017-2121039 R cgctt CGGTCAGGGCCAACTATTGCCTG aaaaa - 0 - 1.268 2121048-2121065 R taaat AACGACAAAAATAAAATT ggccg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back