cpxR

Information for cpxR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4101183-4102556 - CDS cpxA EG10163 probable sensor protein (histidine protein kinase); acting on arcA 4102553-4103251 - CDS cpxR EG10020 transcriptional regulator in 2-component system 4103398-4103547 + CDS b3913 - orf; hypothetical protein

Reported regulatory sites for cpxR: Genome coordinates Source Transcription factor Transcription factor annotation 4103327-4103341 DPInteract cpxR transcriptional regulator in 2-component system 4103307-4103321 DPInteract cpxR transcriptional regulator in 2-component system

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.004 4103308-4103330 R atgcg TCAGGGGGTGTAAAACAACGTAA agtca cpxR 18 - 1.900 4103283-4103300 R tcatg GATTAGCGACGTCTGATG acgta - 0 - 1.599 4103376-4103392 R ttgct CCCAAAATCTTTCTGTC gcgat - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back