crcA

Information for crcA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 653806-655191 - CDS dcuC EG13545 transport of dicarboxylates 655780-656340 + CDS crcA EG12180 orf; hypothetical protein 656515-656724 + CDS cspE EG12179 cold shock protein

Reported regulatory sites for crcA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.267 655530-655547 cgtta AAAAATAAAATAATTTTT ccttg - 0 - 0.955 655553-655575 ccttg ATTGCATTTTGTCATCAAAAAAG acttg - 0 - 0.858 655372-655389 caatt ATCACATAATAATGTGTG caaat - 0 - 0.858 655451-655468 gtgcg CTCAAAAAATAATCTAAT atgag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back