crcB

Information for crcB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 656515-656724 + CDS cspE EG12179 cold shock protein 656778-657161 - CDS crcB EG12209 orf; hypothetical protein 657254-657481 + CDS ybeH EG13162 orf; hypothetical protein

Reported regulatory sites for crcB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.483 657203-657226 R aaaat TCGCCAACGACGATTATTCGGCGT tacac - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back