crl

Information for crl, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 256527-257771 + CDS yafA EG11091 orf; hypothetical protein 257829-258230 + CDS crl EG11092 transcriptional regulator of cryptic csgA gene for curli surface fibers 258269-259324 - CDS phoE EG10729 outer membrane pore protein E (E;Ic;NmpAB)

Reported regulatory sites for crl: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.288 257784-257802 ctaaa TTTTGCCAATTTGGTAAAA cagtt - 0 - 3.057 257770-257787 gtgtt AAAAATTTGCTAAATTTT gccaa - 0 - 1.079 257806-257828 aacag TTGCATCACAACAGGAGATAGCA atgac - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back