crp

Information for crp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3483051-3483455 - CDS yhfA EG11182 orf; hypothetical protein 3483757-3484389 + CDS crp EG10164 cyclic AMP receptor protein 3484440-3486530 + CDS yhfK EG12906 orf; hypothetical protein

Reported regulatory sites for crp: Genome coordinates Source Transcription factor Transcription factor annotation 3483621-3483642 DPInteract crp cyclic AMP receptor protein 3483519-3483540 DPInteract crp cyclic AMP receptor protein 3483491-3483506 PMID: 9582281 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription 3483612-3483627 PMID: 9582281 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription 3483631-3483645 PMID: 9582281 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription 3483650-3483666 PMID: 9582281 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.565 3483533-3483556 ctggg TCATGCTGAAGCGAGACACCAGGA gacac crp 8 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.336 3483476-3483492 gcgtc AATTTTCCTGACAGAGT acgcg fis 2 - 2.012 3483614-3483635 gatgt ACTGCATGTATGCAAAGGACGT cacat fis crp 19 15 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back